Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D186G09
Clone ID D186G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD186G09
Sequence
TCAGATAACCTGCTGGGATGAAGAATAAATATCTACTTTATACTACAATGATTTTAAACTACTGTATTATTTAAATTAAT
ATACTTCATTGAAAACATGATTCAAATGATGAAGTATGATGGGGTTTTTTTATATTAAAAGTGAAGTACAGGCAGTATCT
TGTATAAAATCATTATGAAATTGGACATAAATTATCTTATAGTTTAAAATAAATATTTAAGTCATTATGTATTTTTAGAA
TAACTGGTAATGGTTGCAGTGCCTGGACACATTGCACTGGTCCATCAGGAGGAAGCCCGCACTGTAGAATTTATTATGGA
CACTATCTACCTATGTGGCTAGAAAGTATCCCCATGAGGTAGGAATTAGAAGTTAGATAACATGGGCATCTCTC
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84795889..84796282 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


SPLK-Sequence tag 3SD186G09
Sequence
CTCTCACAGTCATTCAACCATACTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es