Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D186G05
Clone ID D186G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD186G05
Sequence
TGCTTGTTTCTTGTACCCCTATAGCACAATGCNNNNNNTCAGCCCTGCCGAAGTTCTGGCATCCACGAGCAGCATTCTAC
TCTCATTTTGACTTTAAACTATTATTGTCCATACTTTTCCCCAGAGTGTCATTCATCTGCTGAATAATCATACTGATCAT
CTTATGCAGGACACTGCCAGTTGCATCCTTCATTGTCTAATGGCCTGCATACATTGCACCAGTTATTTCAGCCTGAAGCC
CTAATGCCTTCCTGT
Sequence Type genomic DNA
Unitrap ID UNI29940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 70261301..70261554 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024511 (Rab27b) NM_030554 RAB27b, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab27b-001]

 
Come back to gene ENSMUSG00000024511


For any suggestions or comments, please send an email to unitrap@crg.es