Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D073A04
Clone ID D073A04
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D073A04
Sequence
GGGGGGAGGCCAGGGAATCGGGCTGCGGAGGGTCGGCTTCGTGAGCTCTGCTGCTTGTGGTTCTTCGGTAGAAGGCGGGC
CCGAGCTCTCTTCTTCGCGGCTGCAGTCACGAAGTGCTCCCGCTGACCGTTGCCTGCATGGGCCTGAGCAGCCTGTCTGC
GAACAAGCCGTG
Sequence Type mRNA
Unitrap ID UNI10402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37298805..37298976 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es