Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D185F06
Clone ID D185F06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD185F06
Sequence
ANGAGGCGAGCTCCGGCTCCGCAGCGTGTGGTCCTGGTTCCGCCGCTGCTGCGTTTNTNNNGAGCCATGGCGCCTGGCTG
CGTCGAGCGAGGGGCCAAGCAGCCGGCTCCGCGACTGAGACGGGGAGAGGGTGTGAGCNNNCNANNNNCTGAGAAAGTTC
AGTCGTNNNAGTCTAGGTTTCCAGAACTCTGCCGAAACCTACTGCAGGGTCCCAANNNACAGTCTGAGGAACCCTCACAG
CTCCAACTAAGGGACGGGCGGCTCCTCGGTTAACCGCCACCCAATTCAAACTCAACGGGCACAGCCTAGCCAATAGCAAA
TCGCCGTCTTAGGACGGTTCTCCCCACGCCCAATCACAATAAAGCTTCTTCTCCTTCCGCCAGCCAATCCTCATGGAGGA
CTTCAATGCCCAGATGTCATTGCGGCACACGCCATCTTTTCGCGACTCCAGAGTCGTGCTAACTGGAAGTAGAGTGGTGA
GTTCGTTCTTGTGAATAAGCGCGGTGTAGTTTTTGATGTACTCAGCGTTGACATCGCAGGATTTACGTTTTCCTGTTGAT
TTAGGGCTGGAAATCTTAAAGAGAGGCGACAAGACTGACTCCAGAAGCACAGGTCCCGGAACAGACAGACCCCAGAGACT
CGCAGTCTAAAGCAGATTGCCCTGTCGTGAAGAAACCCCTTCGGAAGACCCGAAGCAACGGTCTTCCTGCAGAGAGAAGG
TAAGAGGACCGCCAGAATCAATATTCTTGAGTGTCCGCGGTTACAAGACAGAGACACAGCTCCACTCTGCAGCGTGGGGA
GTTGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124613859..124614665 750


SPLK-Sequence tag 3SD185F06
Sequence
GCCCTAGCCTTTTAGGACTTGAGCTCAGTTGATGGCCCTGACGCTGAAAAGAACTCAGCACTAGCTGAGCTCAGTTGATG
GCCCTGACGCTGAAAAGAACTCAGCACTAGCTGATTTATGAAGCAGAGTTACATGAACATA
Sequence Type genomic DNA
Unitrap ID UNI21862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124614662..124614803 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044730 (9930104L06Rik) NP_808241 RIKEN cDNA 9930104L06 gene Gene [Source:MGI Symbol;Acc:MGI:3041172]

 
Come back to gene ENSMUSG00000044730


For any suggestions or comments, please send an email to unitrap@crg.es