Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D185E09
Clone ID D185E09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD185E09
Sequence
GATCCGGAGACCGAGGTCATCTGCCTGCCGAAACCAGCCCCGGAGCCACTATCCCGGACGCTATCGCCTCCCTTCCCAGC
GCTCCTTTCTCCCCGGCGATCGCCACCGCTTCCTGGAACAGAGACGCCCTTCGTCGGCTCCCTGCGGGTGACCGAGGCAA
GAACCACAGCTGGTTGTGTGCAGAGGCCAGCCGCCACTACTGTAAGTTTGCCCTGC
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011284..98011499 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]


SPLK-Sequence tag 3SD185E09
Sequence
CTGCAACCCCAAACCTGTTGCGGGCGCCCGGGTTTCGGGCGGTGGGAGTCGGCCGCGGGGTGTGCTTGGGAGCATCGAGC
CGGCGCCGGCCACCCTGGGTGAGGCTTAAGCCCAGGAGGTGCTCATCGAGGCAGAACAGTCGCTGGAGTGGGAACGGCAC
TGGGAGAGCAACTTGCATCCCCTCTGCGGTGTAACGCCCGGGCAAGTATCGGTGGGTGCGAGGAACCAGGTTGGGGATAA
TATCCCGGCTCCTAGCAGTCTCCAGGAAGCCCAGCGCGTGGGATCGGTTCCCCAGGGTGCCTCGTAGCCGGCTTTGGGGG
GCGGTGGAGGCCATGCGCAGACCTCCTCCTGCGGCCACTTGACTGCAGCCAAATGAATGAAAACTGGTTCCTGAAAAACG
AGTTTCTTCTCCTGCAAGCTTTTGCCTTTTAGAATGACATTATTAATTTCAAAGGCT
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011496..98011951 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es