Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D185A10
Clone ID D185A10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD185A10
Sequence
GATCCTTTAGAGCGTGCCTCGCTGTTAACTCTTGTGCGGTGAGCTCACCGGCATGAGTTACTATAGATTTGTATTCCTCC
AGAGTCTACCCGGTTTCGTTGGGTGGTTTGGGTAGTTGTATTATTT
Sequence Type genomic DNA
Unitrap ID UNI19233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5255443..5255568 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022544 (5730409G15Rik) NM_027446 RIKEN cDNA 5730409G15 gene Gene [Source:MGI Symbol;Acc:MGI:1917761]


SPLK-Sequence tag 3SD185A10
Sequence
ATTTCATCGACATAAAATATCTCTNNGTCTTAACGCAAAACGAAACCCGAATAACATATAAGTCCTTATTCAATGTCAAC
TGTAATAATAGTTCATGTGCTGTGCTAAGTACTTGCTCAGGGTCACCCACAGTGCACAGCACTGGCGTCTGTGGTCACTC
CATTTGACCAGGAGTTTAAGAAGGAAAGAATCAGAGCTCTGGCCGGGGAGGCCAGCTTCCTGCTTATAGTTCTAATTCAA
CCCCCTGTGTGCTGTGGGACTTTACAAGAGGCTACATCTCTGTGCCATCATTTCTAATTAATACAGTAAAGGATACAATG
ATAGCAGCCTCTTGCTACTAAACAGCTGGACTTCTTTTCCTTTGCCCAGCTAGAAATCATAGATAGACAAAAAGTTCTGG
GAGTGCTGATCTCTGCTGACTGTGTTTTTCTGTGCCGGCTGTAGGCAGACAAGACCAGTAATTGCAGGTTTCTTGAGTGT
AGGGCCCTTGGCCCTCCGGGAGTTCTTAGGACATTTTTGGCTGCGAGCTTCCCAGCAGGCCAAGGTATTGGATTTCTTCA
GCCCTTGGCAGCAGCCCTTAGAAACATACAGCTCTTGTGCAGGTCTTGGAAGTGCGGATTCATTAGCTCTTGACCATGGC
CAGCCTGTCTGCTTTTACAATTCTGCCGTCCACTGTTGAGCCTTGACTGGGTCTGCTTTCTCCTTGTTACCCCCGCAGCC
CGCACTACTAAAGTAGGCAAGAGACTCTTTCCCAGAGTAGCGCGGGGAGGGTCCTTACAGTCTACTCCCTCTTTGACCAC
AGCAGCAGGCTGTGTAGGTGTCTGAACCCATCACGGCTTT
Sequence Type genomic DNA
Unitrap ID UNI19233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5254607..5255446 817
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022544 (5730409G15Rik) NM_027446 RIKEN cDNA 5730409G15 gene Gene [Source:MGI Symbol;Acc:MGI:1917761]

 
Come back to gene ENSMUSG00000022544


For any suggestions or comments, please send an email to unitrap@crg.es