Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D184H08
Clone ID D184H08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD184H08
Sequence
GATCTCTTCTTCCTCATCCTCTTCCTGGTCTGCAGTTCTTGCATTTCTTCTTACATCTAGTCCTCTGAGTCAGTCTCCAT
ATCTAGCAGATTTAAGCCTCTCCCTCTCTGGCTCCCTGAATTTGGGTGGGAAAACAGGGGTCAG
Sequence Type genomic DNA
Unitrap ID UNI6870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29204662..29204805 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]


SPLK-Sequence tag 3SD184H08
Sequence
GTCCGAAGGGGCCATGGTGAGTGAGCTCACCAGAACTCTTCCATCTGATACCCCCACCCTTCCCTTTCAGGCTCTACTGA
CATAGTTCATCCAACAATAATGTGAACGCGTGTCTGTGTGAGCTGCGTGAGGCAGAGAAGAGTATGTCTGAAGCCAAGCC
CCAGCCCCTCTGATTAGTGCCACAGAGGCCAACCTGATTGTTACAACACTAAACATATACTAATGGGCTTCCTCTATGTC
TCACAGATACATTTGGCTCCCTATGATTTGCCAGGACCAAGGGTCATGACCTACTTTGCTTGGGATACCTGTCCAGTTCC
ATCCCATGGCCNNTATGCTAACAAGGGCACTCACACAATCTACTTTACCTTCTCTGTGTCCTCAGAGTCCAAATTTGCAT
CTCTGACAGGAGCAACTGCTGGCATTCTTGCATTGCTTGGTTCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es