Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D184E10
Clone ID D184E10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD184E10
Sequence
GATCCAGAAGGTCAGAAGTGTCTCTTCTGCATCAGTTTTGCCTGGATAATGCTTTGTGAATGTCACCTCAATCATGTGCT
TG
Sequence Type genomic DNA
Unitrap ID UNI10651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95660871..95660952 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026280 (Atg4b) NM_174874 autophagy-related 4B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913865]


SPLK-Sequence tag 3SD184E10
Sequence
CTTGTTTGTTTGTTTGAGTTGACACTGTGGGTATGCCCAGGTAAGGTGCCATATTGCATGAATGGTGGTGTGTGTTTTCT
TCCTGTCTTCCAAACCAGTGGGATGC
Sequence Type genomic DNA
Unitrap ID UNI10651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95660949..95661054 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026280 (Atg4b) NM_174874 autophagy-related 4B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913865]

 
Come back to gene ENSMUSG00000026280


For any suggestions or comments, please send an email to unitrap@crg.es