Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D184B06
Clone ID D184B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD184B06
Sequence
GACAAGTTGCCTGCCCTGGATGAGCTGACACCGAGCTTTCTAAATCTTCCCCTCATACACATTCATTCCTTCTCCGGGCT
CGGCAATGCTTTTACTACCTTCTCTTCCATTTGACACTTCATGTCAGGTTTTGG
Sequence Type genomic DNA
Unitrap ID UNI29944

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 69107888..69108021 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032238 (Rora) NM_013646 RAR-related orphan receptor alpha Gene [Source:MGI (curated);Acc:Rora-001]

 
Come back to gene ENSMUSG00000032238


For any suggestions or comments, please send an email to unitrap@crg.es