Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D184B03
Clone ID D184B03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD184B03
Sequence
TTCAGCTTGGGTATGACCTAAGTAGGGCTCACTTGTTAAATATCTTCTTTTCAGTGGCGGTGGCACAATGAGAAAAAACA
TTGATGTCTGGAAGAAATGGACAACCTTAAACAGCTTGCAGCTCCATGGGTAAGTGAATTGNNTAGAGTGAGACAGGCAG
ACTTCAAGATGCATGGCTCCCTGGTAGACCATCTACCGGTGTGCCTCGGATGACACAGTTAATAGTTGCCTCATGAAAGT
TTGCCCACTACAAGTTATGTTAGAGCAGTGGTTCTCAGCCTGTGGGTTATGGTGCTTTTAGGATTCATGTTTCCAT
Sequence Type genomic DNA
Unitrap ID UNI29945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69760429..69760744 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]


SPLK-Sequence tag 3SD184B03
Sequence
GCAGCATTAGGACGGTTGAAAACAATTGCCTTAAAAGTCTTATTTAAGTAAGTGTAGTAACTTCGAAC
Sequence Type genomic DNA
Unitrap ID UNI29945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69761006..69761073 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]

 
Come back to gene ENSMUSG00000021595


For any suggestions or comments, please send an email to unitrap@crg.es