Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D183G12
Clone ID D183G12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD183G12
Sequence
AAACTCCCCAGTTCAGGTTTACCTCTCTCTGTCTTCCTTTGGCTCTTTCAGGAAAGCCTGGCCCTGCTTCTCCATAGCCT
ACAGTGCAAACAGCAGGACTCAGCTTCAATGTACTTATCTTTCTTAGAAAAACCTGCCTTGACTACCTCCCAGGATGGCA
TCTTCCTACCACTTTCTGTACATTTGACCATAGAGTTCCATGCATAGCA
Sequence Type genomic DNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28273241..28273449 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]


SPLK-Sequence tag 3SD183G12
Sequence
ATTTCAAGTACTAATGACCATGTTGCAAGGGCTTTTTGTTCCTTTAATCTAATCTGTAGTAGCAACTTATAACAGAATGC
TGTCTGTATCTCAGAAGCTCACTGAGGAC
Sequence Type genomic DNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28273817..28273925 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]

 
Come back to gene ENSMUSG00000008384


For any suggestions or comments, please send an email to unitrap@crg.es