Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D183G07
Clone ID D183G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD183G07
Sequence
CGAGCAAATACATAGGACTGGGAGTTTGTGGCAGGGGGGAGGTCATTTGGGAAATAATTCATCCTCAGGTATCTCTTGTC
ACCAAACTACAAATAAATAAGTGAGGGGGTTGCTATGATGATTAGACTCACAAGAGATGGGCCTTATGTTTATAAAGATG
ACATGCCCACAGCAGCACAGATAGGTGGCCTTCAGAACCAACATGCAGGCAGTACAATGTTGCACACTGCATTCTCAGCC
ACTGTCTAAGTTGCTCAGAAACTGAGTTTCAGAAAGGAAGACTCTCTCACATTAGAACTTCCCCTGACTGATTCGGCTGC
TTAAATGGAATTCCTAGGAATATTTGGGAAATTTTTAGGCTGCAGGCCACTAATGTTTTTCCTTATATTTGTTTGAACTG
AGTAATCTGTCTATATATGCCTGCCTGCCTGCCTTGTCTATCTGTCTATCTAT
Sequence Type genomic DNA
Unitrap ID UNI4745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14158125..14158577 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060657 (4921513D23Rik) NM_001081154 RIKEN cDNA 4921513D23 gene Gene [Source:MGI Symbol;Acc:MGI:2444505]


SPLK-Sequence tag 3SD183G07
Sequence
AGTGAAGTGGTAGATATGGTAGTTCATTTTAGGATTTGGCTTTGAAAGATTTAAGCACGCTGAAATTATGAACACTGTGA
TTATAACAAGTTCTTATGAATAAGAGTGGAGTGTGTTGGGTGATATAAAACCTGGATTTCTGGATTTTTGTGGGGTTTGT
T
Sequence Type genomic DNA
Unitrap ID UNI4745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14157763..14157923 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060657 (4921513D23Rik) NM_001081154 RIKEN cDNA 4921513D23 gene Gene [Source:MGI Symbol;Acc:MGI:2444505]

 
Come back to gene ENSMUSG00000060657


For any suggestions or comments, please send an email to unitrap@crg.es