Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D183F08
Clone ID D183F08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD183F08
Sequence
GATCCGCCAGCTTAGCTGTCCCGATACCCGAGGGAGGGA
Sequence Type genomic DNA
Unitrap ID UNI29946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33009340..33009378 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


SPLK-Sequence tag 3SD183F08
Sequence
GAGACACTGAAATTTAAAAGAAATTTTCTCTCTACATGTGGATGAATTGATGCAATGCTGATCTGAAATTTGACACAGAC
AGGAGCTATAAAATATTTGGTGCTTTTATCATTTGGAATGGGACGTTGGGACTGATGGTGTAGCGGGTCCTTTAAGAACT
AGAGGGATATTATTTAAAATACACCTTTAG
Sequence Type genomic DNA
Unitrap ID UNI29946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33009018..33009208 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es