Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D183E12
Clone ID D183E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD183E12
Sequence
GAAATAGCTTTTCTAGAAACAGGTTTTGTTAAGTGGAAACTTCATTACAA
Sequence Type genomic DNA
Unitrap ID UNI13456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22094493..22094542 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]


SPLK-Sequence tag 3SD183E12
Sequence
ACTTCATCACAGCAGAAAGAGAGAGGCTAGATGGCACGGCGTCTTCTTCCCCTGTGTTTCAACCCTGGACAGCCAAAGCA
AGCGTGCATCTTTGGGATGTACAAAGACAGATGGCAGCCTTTATATCAAATGCCTGATGTGCCTGAATTCAAATGCATGC
TGCCTTTCAGGCAATGCATGAGTGCCCTTACTTACCCCTATCTGGGGGCTCTCGGAATTTGTCCCACCTATATCTGGGGG
AGGCTCTCAAAATTGATCTTGGTCCATGAAGTGTGCGTGACAAGGCCTGTCAAAACTAAAGCAGGTGATTTCCCACATGT
CCCCACCTATAGGGACGTTTCTGGTATAACCTTTCCCGTAGGAGAGTTTGGTAAAAATCTCCAGTGAGGTCAATGTCCAG
AGGGAAAGCCATGCTTTATTTCTAAGACCTGTTATTAAAAGGGATACACACTACACGGGATC
Sequence Type genomic DNA
Unitrap ID UNI13456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22093628..22094089 460
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es