Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D183E02
Clone ID D183E02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD183E02
Sequence
TTTTTTTTCTCAACAAGTGTGTGTTGATCACACAAGCCATGCGCGTAGGACCTGGATTTTTGAAAACACAAATCTGGATT
ATGGTGAAGGAGACGGATGTGTAAACATCACGGGACAAATAGAGTTGTTCTGAACAAATTTCTTTGGAAGTAGAAGAAAA
ATTTATTTTCTCCGAAAATCCAAGAAGTGATCTTTGA
Sequence Type genomic DNA
Unitrap ID UNI12956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29400364..29400556 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]


SPLK-Sequence tag 3SD183E02
Sequence
CTCCTAGTGCCTTGCCTACCATAGTGTGTGATTGTGCTCAGATCACTATTGCTAGCAGACTCCTGTCCCGAAGGCAACAG
GATCACACACACCCCTCCAGTTTTAGCAGAGAAATGGTGCATTTTATAGATTTACCTGCAACCTGGTTTTCATACTGATT
GAAGGGAACCCTGCTTGGAGCCTGGTCTGCCCTGTCTACTGACTTGAGCCCCATTTTGTCTGCCCTTGGCTCCTGAGTGT
AGACATTAGGAAGGCACGCACCACTGCTCTCGCTCCCAGTTCTACAGAGTGCTCACATTGCTGGACCTCCTGAACTTGGG
CCATACAGATTCTCCCCAGAGCTCAGTGGGTAATGTACAGCAGGAGCCCCCTGCCTTGTTTTATCCTTAACAGCACTAGG
AGAAGAGAATAAAAGCACTCGTATGGGTGTATGTGGACATTTGAAGTAACCAGCCTATTTGCTTTACACATTCTCTTTAG
ATTTGA
Sequence Type genomic DNA
Unitrap ID UNI12956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29399686..29400168 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]

 
Come back to gene ENSMUSG00000024007


For any suggestions or comments, please send an email to unitrap@crg.es