Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D183A09
Clone ID D183A09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD183A09
Sequence
GGATCTTTCTCTGTAGCTCTGGAGTGTGTGGGGGGTGGGGACGAGGACTCTGAGCTCTTTCTTTAGCCCCGTGGCTAGTT
TTCTATTATCATCTTGCTCCTCTCTACTTTCCTAGCACTAGGACCGAAGTCATCTAACAAACGAATAGAGAAGATAATAT
TAGCTTTTTTAAGGTAAGATTCTCAACCAGAGATAAAGGTGGCTTACTTTGTGGATGCCTTTCATTCATGCACTTCCCTC
CATTCATGTAGAAGGACTTGTTTGATTTTGCTTTTCCTAACCAGGTTAATACCTTTTGGGCAGAGTGATTTGTTTTAGAT
ACTGGTAGTTTTCTTGGTGTACCTCACTAGCTTTGTCTTGCCTGCTCAGGTTAGGATGAAGTAGGAGTCACTGATTAATG
TAA
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106675284..106675686 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


SPLK-Sequence tag 3SD183A09
Sequence
TAATTGAATGTACCAGACCAAATTTCCTTNTGGGTTATTGAATTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es