Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D072E04
Clone ID D072E04
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D072E04
Sequence
GCTGGGGTTTGCTTCCACGCGTTAAGGCTCTGTTTACGCGGACCCGCGCTGGAGAACTGGGCGCGCGGTGTGTGGTCGCT
GTCTGCCTCCGGCTACGCCACTACCTCTCCTGCGGGGCCGAGGGAGCCGTGCAGG
Sequence Type mRNA
Unitrap ID UNI10405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150574835..150574969 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033068 (Entpd6) NM_172117 ectonucleoside triphosphate diphosphohydrolase 6 Gene [Source:MGI (curated);Acc:Entpd6-001]


SPLK-Sequence tag 5SD072E04
Sequence
CCACTACCTCTCCTGCGGGGCCGAGGGAGCCGTGCAGGGTAAGCGGGGCCAGCGAAATGTGCTTGGCCCGGAGGACTGAC
TACGGTTGGTCTCCCCACGCGCGCGAGGGACGGGGTTCCCC
Sequence Type genomic DNA
Unitrap ID UNI10405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150574932..150575052 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033068 (Entpd6) NM_172117 ectonucleoside triphosphate diphosphohydrolase 6 Gene [Source:MGI (curated);Acc:Entpd6-001]


SPLK-Sequence tag 3SD072E04
Sequence
TCACTTGCGCTCTCGGTCCATTCAACTGGCTGTCTTTCCGACCCTGCTGCGTAGCCCTCGCACGTCTACAACACACCGTG
GGACTCGTGAGCTATGCTGTAGGCCAAGCAGCAGGGGTCTCTGCCCGAGTGTAGCCCACAGCCCTGCCGCGTCCATTCAT
TCTGCTGGCTTGTGCTGACCCGCCCCCAGCAGAACCAGGCCCAGGCGCCTCCCCTTCTGCACTGGATAGCCCAACTGGGA
GGCTCAGGAAACCGGGGAAACCCTGTGTTCTGATTGTGTGGAAGGGGGGAACGGTGGTGACATGGAAGAACTTACCAGGG
GTCAGGGTGGTTCCACCTGAGTTGGTGTGTGGCCACAGGTGCTTCAGGTTAAAGGAGAGAGAAAGGTCCAGATGTAGACA
CCCAGAATGTAGGACAGGGAGTCAGTGAGAACACATTTTTATTTTAAAAGCATCAGGAAGTAATTGGTTTTGAGACAACA
TTGCTGAGTAGGTCACAGTGGACACAGCCCTTCACCCTGAGAGTATAT
Sequence Type genomic DNA
Unitrap ID UNI10405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150575119..150575646 526
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033068 (Entpd6) NM_172117 ectonucleoside triphosphate diphosphohydrolase 6 Gene [Source:MGI (curated);Acc:Entpd6-001]

 
Come back to gene ENSMUSG00000033068


For any suggestions or comments, please send an email to unitrap@crg.es