Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D181H04
Clone ID D181H04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD181H04
Sequence
GATCCTCTGGAATTGGAGTTACAGACAGCTGTGAGCTGCCATGTGGATGCTGGGAATTAAACCTAGGTCCTCTGGAAGAG
CAGCCAGCACTCCTAACCCCTGAGCCATCTCTCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4799188..4799305 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]


SPLK-Sequence tag 3SD181H04
Sequence
TCGGTCGCAAACCCTGAAAAGCTTTCTCTCCTAACAGCCTTTTCACCTGGAAGCACAATGTCATCAGAATCCAGCAAAAA
ACGGAAACCCAAAGTGATCCGGAGTGATGGAACCCCAACTGAAGGGAAACGGAACCGGTCNNNACACGAGCAGGTGAGCA
CGCTGCTGGGAAACTGCAGACT
Sequence Type genomic DNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4799757..4799938 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]

 
Come back to gene ENSMUSG00000034274


For any suggestions or comments, please send an email to unitrap@crg.es