Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D181B09
Clone ID D181B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD181B09
Sequence
GATCTGCCCTGTGAGGCTCAGGGAGAGAGAGAGGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI6726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56820726..56820763 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]


SPLK-Sequence tag 3SD181B09
Sequence
CCTGAAGCTAGGTTCTATTGGGTGATGGCATCTGTCCCAGTCAAGTGTGATCAGGTGCCTAGTATGGGAGGGGACCTGAC
CTCTTTTCTTCCCATGATGTTAAGATGGGTATGCTGATCTTGCATGTGCTAAAGCTTGGGGTTGGTGGCTCTCTGGTCCT
GTGCTTTGTGAGTGCTAGTTCTCCCCATTCCCCATCTGCTGTGCCCAGTAAGTGTTGTGGGCATCCTCTTATGGCAGTGA
GTTGATGGAGTCAGACTGTGAGGGGCAACTGCCTGCCAGCCAAGTGAGGTGGACTGCCCTCCTTTTCAGTACCATGACTG
CTGGCAATTCTGTCATTGTTGGGTGACAGGAAGGATGCCAGAAGTGCATTCCCTCCCACCTCCTGGCACTGACCACCACG
GTGCCTTCTATGTTTTAGGCTCCTCAACTTACTTCTGTGAGACTGTCCCCTCCATGAATGTAGCTGCTCTATGTTTGCTT
GGTTCTGAACTTCCTAGTTAGCTGAGATC
Sequence Type genomic DNA
Unitrap ID UNI6726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56820762..56821270 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es