Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D179H11
Clone ID D179H11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD179H11
Sequence
GAGGGACCAGAAAGTAGTATGGTTCGGTCCATAAAGGCACAGGACCTGTGCCCAAGCCTGTTGACCCACAATGAGTGCCT
GTGTGCTGCATACACACACAGAGTAAATAAAAATTATTTTTAGAAGATCGATATTTTCTTAAAAAAAAAAATAAGATCAA
AGGACTGTTT
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55699491..55699660 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es