Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D179G12
Clone ID D179G12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD179G12
Sequence
CAGCTGTCNNNNCTGTGCTCATGACCGTGAACAGACCCAAGACAAAGCGCCCTGTGACATAGAGCTGCAGACTCTGCGAA
GCAGAAGTAGTCCTTTAAGTCTATTCCAGTCCCATGCTGTGACCTATGGTTACCCTGCTAGGCTGGCCCACCCTGGGGCA
TCGTAGGCCACTCAAAGAGACAAAGTAAGAGTAGATGCAGAGGGAGATGCACTCAGTATGGCAACACTGGGAAGGGAAAC
TAACAAGCAAAGAGGTTCAGTCGATTCTAATATGAGGCTTAGGTCTAAATAGAGGGTGAGAGACATGCACAGCTAAGCAG
CCCTGGTAAAAGAATGGTCTCCACCACCCTGGTCCTCATCGCCTTAGTTCTAATGTCTCTAGCAAAGTGGCCTGAGAAGA
TGCCACGCTGTGTGAAATCACTATGAGTCACTAGGTTTTCCTGCAGCCGGCACCAGGCTTCAGCCCTTTTCTTTTCTACG
CACGGGATGCCTAAGGAAATTCCAACTTACTTGGGACCACGGCTTAATGATCTGCTAGCCAAAAGTGGGGAGAGATATAA
GTTTCACTTTAGAATGTCTTCATTCCTGCCAGGGGGTTCCTGTTCTAGGGGCCCCCACTCTCCTGAGCATACA
Sequence Type genomic DNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55002058..55002690 611
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]


SPLK-Sequence tag 3SD179G12
Sequence
TACATAGGCAAGCACATCTGTGTTTGGCGTTTCTAATGAAAACTTGGCTTGCAGAGCCTAAAGGTGGAGAGTGGCCATTG
CCAGATAGGGAGAGACAGGTTTCTCGTGGCGTTGAAATAGCTCAGGATGGAAGTCCAGTGGGTAGCGAGGGATGGACGAC
TGGCTGAGGAAGAGCAGTGTCTGACAGGCTTGTGGAGGGCAAGATAAAGACACGTTATTTTGTGGGATTACTGAGGAGAC
AGTACACTACCGTCTTTAATGATTAACTTAGCACCGGGGTGGCCTGGAGCGATGGGTACGTGTTTGCTCAGCCTTTCGAT
AAGGTTTGGTTGTTTACTGTTATGTCTATTAGGCACAAAGACATGTATTTGAGTAGAGCCAGAAATCTCCTCAGAAGAAA
ACAGAAT
Sequence Type genomic DNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55001655..55002061 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es