Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D179C12
Clone ID D179C12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD179C12
Sequence
GATCCCTACCTGCTAATGGCTACTCGGCCGTCTTTTCCTCTCTCCTCTAATGCCTCATTAGGAGATTCTCCCACACCGAT
GACTTTGAAGCCTTTCTCATCTTTCCACTATGCAGTTAGGGCTAAGAGTGTTAGGACTAGAGGGAGAGTCTAGGTCCTCA
TGACGTTGACATTCCTGTCTGGGGCCCTGCCATTCTCTACCTCTGCATCTCCCATCAGCCCCTGGGAAGCAGCCTATCTC
TCTATCCTTCTCCGGATGTGACACTCCCTTTCCTGG
Sequence Type genomic DNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96608554..96608829 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]


SPLK-Sequence tag 3SD179C12
Sequence
CTGGCTCTGTGCTGCANNNATCCTCTGCCTGGAGTTGGCTACAGTGTTCCCTCCTGGATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es