Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D178H08
Clone ID D178H08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD178H08
Sequence
GATCTGCCCCCACGCCTCCTCCTCCGCCCGGCAGCCTTCCTTTCTCGTTCCTGACGTTCCTCCATCCTCAATCACCTGGG
ATTGACAACAGCCTTCCCCTTCCTCTCTTAGCTGCCAGACAACTACTAGGAGCAGGGGTTCCCG
Sequence Type genomic DNA
Unitrap ID UNI14487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70998945..70999088 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022095 (Rai16) family with sequence similarity 160, member B2 Gene [Source:MGI Symbol;Acc:MGI:3036290]


SPLK-Sequence tag 3SD178H08
Sequence
GAGTTCCCTCTTAGCATGGGAGTTGCAGCCCTGAGTGACATAAGTCCCAGGAAGAAGGTGATAGAGACCTTTGCAGGGGT
GGGTGGTCGCGAGAACCCGGAAGTAGCCCTCTGCAGGCTTATCTCAAGCCACTGAGCCAGCTGACCTTGAGTTAGGG
Sequence Type genomic DNA
Unitrap ID UNI14487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70998784..70998940 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022095 (Rai16) family with sequence similarity 160, member B2 Gene [Source:MGI Symbol;Acc:MGI:3036290]

 
Come back to gene ENSMUSG00000022095


For any suggestions or comments, please send an email to unitrap@crg.es