Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D178C04
Clone ID D178C04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD178C04
Sequence
TGAGGGGAAGATTTTGTGTATATAGCTATGTACACTGCTTAAGGGCTCAACGGAATAGTTGTTAAGCCTGCCAGTGCCAT
AGGCAGGAAGGTGGTACTAAGTGCGTATGTGCTGCCAGTCTTGTTCAAGGCAAACTTCAGNNTCCTTACCCACTACCCAG
GATATACACAATCAGAATGTGTTGTCGTGCCCTCTGTTACACTTCTCTGTTAGTCTCCACCGTCATGAGCAGTCATGAAG
TATTTGGTGTCATTNNTAGGTCATCCCTCATCACTGAATAGTTCTGAGTATCATACATAAATGGATTGTCCAATGGGTGC
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106679103..106679423 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


SPLK-Sequence tag 3SD178C04
Sequence
ATGCCTGACAATTCATTCTTCTCATTCTCAAATAATACTATATTTTCTGTAGATAGTCTATATTTTATTTCTCTATCCTG
TCAGTTGATAGAAGAACCTTACTTTTTTCTGTCAGTGCTGTACTTTTGAAGCACATGTTCTCATATCAGCACCAGTTGGC
TGGCCATCCATGGCACCTCCCTTGTCACTCTCTGGCCAGCATGCACTGTATATTATTAGTGTCAGCCATTGCTAGTTAAT
AATAGATGTTTAATGTTTGTCTTCCATTCCAGAAAACCTATCACTTTGTATTTTTAGCACTTTTCAG
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106678508..106678814 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es