Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D175H08
Clone ID D175H08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD175H08
Sequence
GAGTTGGAAAGTTATTTTTAGCCTTCAATGCTTGAAGACCCTTGGGCTGGCCTAGAACCAGTGTCTGTAGTGGATATAAG
CCAACAGTACAGCAATACGCAAACATTCACAGGCAAAAAAGGAAGATACTTTTCTTAATATTTCTGAAATTCACCTGGAA
GCTTCATGTGTCAGGAACATCCTGGACAGAACTTTTACTTGTGTAAAAGAGTTGAACCCAAGGATGATGACTTTGAATAA
TGATTAGCAGACCTTTGGTATATCTCCAACTTTATCAAGTGTTGATAACAGCGGAAATGATAGNNNTATTNNNAGTATTT
AGNTTTNGGGGAGT
Sequence Type genomic DNA
Unitrap ID UNI29963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17788739..17789072 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012429 (2810021B07Rik) NM_025479 RIKEN cDNA 2810021B07 gene Gene [Source:MGI Symbol;Acc:MGI:1913558]


SPLK-Sequence tag 3SD175H08
Sequence
TTTAAAATAAAACGTTTTTTGCTCTTTCTAATTGTGATTTTTGTGAATATGTAGAATTGCTAAAACAATGCTTCAGTAAT
CACTTAGACTTTGAGGGTAAATGTTTTGCAAACTATTTTTTAATGAAATGACAAGCTATCTTAGACAGTTTTCTATATAT
TTATTAATAGAAAATAGTTCTACATCCATTTTTTTGTATTTTTGTTAAGATATTGAAACTTAAAATCACTGGAAGTCACT
TAATATGATTTATACTTCTTTATTCACAAAAGGCCAGAATAAACTATATATATGCAGTTCAGTGCTCTGCCCAAATTTCT
CTATATTTGGAGCATTGTAGGCTTACTTTCTCTTGAAGCAAAAGAAGGTGGTATGTTGATTTTCATTGTGATAAAATGCC
AAAGGAAAACCAAGGAGGGACTTTGGTTCATAGTTTCTAAAGTTCCAGTGGAAGTTCAGCTGG
Sequence Type genomic DNA
Unitrap ID UNI29963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17789141..17789602 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012429 (2810021B07Rik) NM_025479 RIKEN cDNA 2810021B07 gene Gene [Source:MGI Symbol;Acc:MGI:1913558]

 
Come back to gene ENSMUSG00000012429


For any suggestions or comments, please send an email to unitrap@crg.es