Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D175G05
Clone ID D175G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD175G05
Sequence
AGGTCTTTATATTGAATGAACAGGAGGCAGGAGCTGGAGCCCACAGGAGGTGATGGAAGGAAATGGTTTTGCTTTGTTGG
TCTCCCCACTCCCATCCCTCACCCTTTGGTAGGGTAGGGTGGTGAAACTAGGCCCTGCTAGGCTGGCCTGAAACTCATCC
TT
Sequence Type genomic DNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104617758..104617919 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]


SPLK-Sequence tag 3SD175G05
Sequence
ATGCCTATAATACCACATTTAATGGTTAGGGAGCAGAATGATCAGGAATTTAAGGTTTCCATTGGCATATAGGAAGTTTT
AAGCCAGCCTGAGCTATGTAAGACCATGTCTCAAAAAATCAAAAGCACCTGTGTGACCCAGTGCTAAGAGAACATCACAG
AAGTGGGGTCAGAAAAGTATGAGAGTGGGCTGATAGGAGTGGGGGGCTGTAGAGTGCTATCTTTCGGACACGACCAGCCC
TTGAACTCACACTAGCTTTGTTACATCCGCATCAGCGAGGAAAGAGGTCGTAAGGCCCCCCTCTACCTGACGGTTTATTG
GAAGTTGATGGCTGCAGGACAAGAAAGGGTCTTTTTTGTGGGGGGGGGGGGGGGCGGGGGGGTCCCCCCTCCCCCTGGGG
GGGCCCCCCCAAGATTTTGGGGGAAAAATTTTTTGGCGCGGGGCCCCCCTGGGGGGGGGGCCCCCCCCCCAAAAAAATTT
TTTCCGCGGCCGGGGAACCCTGGTTTTTTCTGGGGGGCCCCCCCGGGGGGGACCCCCGTTTTTTTTTAAAAAAAGTTTTC
TCTTCCGGCGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es