Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D175D05
Clone ID D175D05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD175D05
Sequence
TGGGTGTGAAGCTCAATGGGAGACTGGAGAGTGCTTGTCTCCCATGATAAAAAGGCCCTGGATTTGGTTCCCTATCACAA
GTCACCGGTTTCAGTCTCCTCCACATCCCCCAAAGTAACAGAAAGTACCTGTTTGAAATCTGAGTGTTAAAGTCAAGCCA
CCACTTAGTATATGTTGGCGTGTGTCTAGTGCCATCCAGTCCCTGCCCTCTTTGTCATGTGCAGCTCTGCCAAGTTGAGG
TTTTGAAGCCAGGCGACTGTGGTAAGGCTCCAACCCAGTGCCCTGGTCCCAGTGACCTGAGTGGGTTGCACAGCTGCCTG
GAGCATGCTCTCTGGGGACCTGGGGTGTGGCTACTTCTGAAGGTTGTTTCCGGAATGGAGTGTGGTGAAGTCCTAGACTT
CAGGTTAATGGTGGGAGGTGGCTGAGCTTGAATATCTGCCCTGGGACACTGGGGGCCTGTTACTATGCCTGCAGTGGGTA
TCGTGCTGACTGTGTGCTGCTTTTCCTTGTCTGCCTCCTGGGACTCTCCAGAGTTGGGAGGAAATCTCTGAGTTGGGTGT
GGCTCTGGCTGCATGGAATAGAAGGTGGGTTTGGATTTTTTTGGTTTTTGTCTTTTGTCAGAGTCTGGCTGCTCACAGTA
GTTTTTGCTTCTTTGGTT
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59467736..59468393 658
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


SPLK-Sequence tag 3SD175D05
Sequence
TCTCGTAGCCGGCAAGCTTTNNNCNAGTTTCTCGCAGATCAGATTAGTTTCTTGTTCATGACTTTTGCGTTGGGGAGAGA
GATGAGCCTTCTCTGCCCACTTTGGGTAAATGCCATTACTACTTTGTGTCTCCTTGACTGGACTTCTCAGCTCCTAGCTC
CTTGACCCTCACCTCCACCCCTGTGATACTCATTTTGTGTTCTTAGCCCTATCTGTTTCTGTCACGGGCTCCCCAGTGAT
TATTTGCAGGGATTGCTCTGTCTCTGCAGAAGGGATCAACTTGTAACTCCCTATGGAGTTTGGTTCAAAGGTCCGTGGAG
GGAAGCAGCGAGCGCCTAGAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es