Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D175C12
Clone ID D175C12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD175C12
Sequence
TCCAGGGAGCCGCCGCGCGGAGAGATGGCGGTCCAGGGTCTACGGAGTCCATGCTAGGCCCGGGCCTTGGTGGCCTCCCA
GTTCAAGACTGGACTAGGAAAGAATGTGTGTTTAAGACCGGAGCCCGAGTGGTCCATAG
Sequence Type genomic DNA
Unitrap ID UNI2754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110310118..110310256 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036057 (Ptpn23) NM_001081043 protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]


SPLK-Sequence tag 3SD175C12
Sequence
CAGTTGGATGTCTGACCCTCCAATTCTCTATGGTCTCCTGACAAAATTTCTGTTCCAAAGTTCCTTTGAACCAAAAAGAC
AGTTTCTTGTTGATGATTAGAGGGCTTGAATCACGCTAGGGCTCTTGGCATCCTATGAGTCATTGTGCTGGCTAGAGCAG
TCGTTTGGAGCTCACTGAGGCAAGGGGTTTCCGTGGTGAGATCAGGTGTGGTGATGTGGAACTGGGTAACCTCCGAGAGG
GCCGTAGCAGCAGTGGGCAGGTGGGGAGCTGGGAGGAGTCTTGGGGATTTAGCACAGCAGCGGTTGGAGTAGACAGTCTA
GAATCCTTTACCACTCCGTGGTATTTAGGGAAAGGAGGAGAAAGAAAATGGGTTTGGAAGTAGTTTCCGATGGACTTGCC
TCCTGGATTCTCTTCATATCACCACTTCCTCTGATCAGGCCCTACTTGCTTGAGGATAGGGTGAGGTGCATTCAGGTGCC
GGGTGTGTGGATGTGGTGGTGGTCCAAGCT
Sequence Type genomic DNA
Unitrap ID UNI2754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110309563..110310072 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036057 (Ptpn23) NM_001081043 protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]

 
Come back to gene ENSMUSG00000036057


For any suggestions or comments, please send an email to unitrap@crg.es