Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D069E08
Clone ID D069E08
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D069E08
Sequence
ATAAAAAATAACTCTTCCGGGGGCAAAGCCCTCAAGTTTCTCTCTGTAGCTCAGGTGACCTGAGTGTTTCTATGTGTTGC
GTTCTTACTGTCTTCAGTGAGTGCTGCGAGGTAGCTCAGGCAAGCTCAGAACTTCAGACATG
Sequence Type mRNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176858933..176859063 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es