Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D174E03
Clone ID D174E03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD174E03
Sequence
GCGCGCACGTGCGCCCATGTACACACACATAACCCAGGATAACAATACTTCAGAGTCAGATACATTCGTTAACTGCAGCC
AAATATTAGGTCATTCTGGCAAANNNGCACAACCGTTTGAAAAGTGTTATATCGGAATTATCTTCAGGTGCTTCAGAGAT
AATTGTGCTCATAAAAGCCAACTGTGTAGTCCGTCCCAGAAGGTAAAATGGTAGACTCGGTAAGACTTGCTTTGGCAGGG
GCTGGAGGGATAAACCAGTTGGCTGATGCTTGCCCGGCATGCATGAGGCCTGTGCCCCACACCCAGTGCCACCCGAAGTC
CAGCACTGGGGAGAAAGATGTCTTCTGTCACTCACTGGCCCATGGCAGGCTCTCACTGATCTAGAAACTCACTGCCTGGC
TAGGTGACTGCCTGGATCCACCTTTCTCT
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121242537..121242965 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


SPLK-Sequence tag 3SD174E03
Sequence
CTCTGTCCCTCANNGTGAGGNNGCAGGCACACGAGGCCGCCACTGGCCCTTTCTATGTGGTTGCTGGGGATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es