Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D173H11
Clone ID D173H11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD173H11
Sequence
AGGCGTTCAAATGCATTCACTGAAATCAGAAGTAGCTTTCTGGCCAAGCAGAAAGCTCCACATGAAACCCATGTTAATAG
GAAAGGAGGCTGTAAAATGGAAAGCTGGAGCCGTGCTGGTGTTCCCCCAAGCAACAGGCTAACCACCACCACTCCCTAGG
AAAGTCACTTCTCAACCAATGCCAGTGGTGGGTCTCCCTGAAAACACTGGATTACCGGTGGGTAGGGTGAGTGCCGCGAG
ATTCCTCCCTCCCAGGTGGCTGGCATAGCTTTTCTTGGTTTTGAATCCGAATTGGAAAATCAAATCAGCAGGCCAGGATA
AACCAGAACCAGCAGCGGGAAACACACTTGGCTTTTGTCTGCACCGTAGAAGGAACGCTGGAAGTTCCTCCCTGTGGTAG
GGTACAGTCCTGTGACAGCAAACTCCAGGTCTCCCAAGAAACAAGCACGGCGAACTTGTATTTTTCCAAGTTGACTTTAT
GCTTGAACCCCCGCAGCCTAGACCAATAGAGCATCCTCCCGGGTGGGCGTGGCCATGCTGTGTGGGCCGGG
Sequence Type genomic DNA
Unitrap ID UNI13115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71157860..71158410 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]


SPLK-Sequence tag 3SD173H11
Sequence
AAACAGACACACCCCCTCCGAAACAAACAAAACAAATAATTCACTGTATTCAGCACTTAAATAATCTTAGGGCAGAATCG
AGTTAAAACTCCATATTCTAGCTTTCTGTGTTGGAAACTTTCCATGATCCTAGAGTTTATATGACTTTCAGAGTCTTTCT
AAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es