Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D173D06
Clone ID D173D06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD173D06
Sequence
GGATCTTAGGACAAAGATTAAAAACTAGGGAGGGTTTTTTCTGCTGGGGGCACGCAGAGAGAATACAATTTGAGAGAAAA
AAACAAAAAATTCTTTTTAATCTTCAAAAAAGCACCTTTTTCCTCTTCTTTTTGTNNTGGTGAACCTTATGAGGCAGCAG
TCTCCTTGTCATGAGAGAAGTCCTGAAAAGCAGTTATTTCCTTTCTCTGGCCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD173D06
Sequence
CTTGTTTTCCTGTTCATCAGCAGAGACCTCTTGTTCCTGTCAGTTGTCCCACCCACTTACTGTCTTGTGAAGAGAACTCA
TCAAAACTGTACCTAATAAAATATGAAACTGTTAAGTCTCAACTTTATAAATACTGAGACCTTTGGAGGAGTGTCCGAGC
TCCCCTCCCCCGCCCAATCCCCATGTCTTCAGGAATCAAAAGTATTGGCATTATCCCAGTGGAATTTTCATCACAGGTCA
CAACTGATGTGCGTCACATTTTACACCGTGCCTGCCAGACGGGTGCCAGACCTCTGTAGGCTTCGTGCTCCACCCAAATA
CTTAAACCTGGTTTAGAGAAGATTCTCAGACTTGCGGGTGAGCCAAGGAAGGGCTATATTTCGTTGCCCTTTTGTGAGGC
AGTTGAACTGGAAAGAGTTAATTATGGACCTGGGGCTGGGTGCCTGTCCCAGAGTACGCCCTACACCTAGCCTGGGTCTT
TGATGGAGACTTGAAGGCAGTCTAGAGGAGAGGGGCATCCATTTGCACTAAGTGTATATAGAAGATGCACAGTGTAGGTT
AAACAGTGTAGGAGAACCCTGAGGATATTACCAAATTGGCACGTGTCTGAATTCCCACGTCTCTGAGGTCCGTGCCACGG
AGAGAAAAACCCAGCGGCGGCAGCAGTGGCAGGGTGTCCTCACTCTGCTTGCTGTTCAGCTGCCAGGATC
Sequence Type genomic DNA
Unitrap ID UNI2083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65210875..65211584 706
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es