Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D173C06
Clone ID D173C06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD173C06
Sequence
GTCGTAAAAGACTAGTAAGCATTAATATCTACTTGAAAGAAGAACACATGACTTGCTCTCTTCTCCTGTTCATCTGGGTT
CCAGGGTAACTGGTAGCAACCACTCCTCTTGCTATATCATTGGCATACTTTTGAGTACATAGTTTATATTTTTCAAAGAG
AATGGCCACTGTCATAACTAGAAATGCCAGATCAGTTGTCTAGGTATAGAATACTGCATAGACTATTAATTTTTAATGGA
TTGTCTCCTAATTAAAAAATGTGTGT
Sequence Type genomic DNA
Unitrap ID UNI17406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87438313..87438578 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]


SPLK-Sequence tag 3SD173C06
Sequence
TGTGTCACTCTATTTAATTCTCTCTTATCTTCAACTCCTTCGAAACTTGCAGACGTCTGTCTCAGCATNNNTGAGATGGA
GCAGGCTGAGGCCCAGCTCTCCGAGTTGGACCTCCTGGCCAGTATGTTCCCCAGTGAGAATGAGCTCATAGTGAATGACC
AGCTGGCATTGGCGGAGCTGAAAGATTGTATTGANNAGAGGACAATGGAGGGGC
Sequence Type genomic DNA
Unitrap ID UNI17406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87437598..87437811 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es