Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D173B08
Clone ID D173B08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD173B08
Sequence
CTTCATTTCTCCCTCCCATCCCTGGGAAAAAATATCAATCCATGAAGATTGTAGGCGGAACCGTGAAGGCCAGAGATGTG
CTTCCAGAAGTAGGCAGCTA
Sequence Type genomic DNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45183809..45183908 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]


SPLK-Sequence tag 3SD173B08
Sequence
AGGGAAAATCCCAGTCCCCTGAAATGTAATTTCCTACCAAAAAGGAGGGAATGGCATTGGTCCCCCTCCCGGGCCGGGGG
GAAATTTCGGGACTTTTTTTTCTACGGGGATTGCTCTCGGGCCCCTGGAAATGTTTTTATGTGTGTTTGGCACACATCCC
CCCGTGTGCTTTTCCAACCCCAGAAGGGGGGGATCTTTTTTGTGCTGGGGCAACCCACCCTCGCCCCATGATTTTTTTAT
AATGCAACTGGTTATTTAAATTTGCGGGAACAAGGAATAGGGCTATTAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es