Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D172E05
Clone ID D172E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD172E05
Sequence
TAGGAAGAATACAAACCCTGGTACTTGCAGGCAAAGGATGGGGG
Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101974018..101974061 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]


SPLK-Sequence tag 3SD172E05
Sequence
GGGGGATTCAGGCAATGTTTACGTTCTAATTTTTCCACTGCCGTTCTGAAGTTACTTGCTAGCTTTTGAAAAATTTAAAA
AACCCCAGAAAATCCATTAGACATAAATTATGTATAAATCATCTTACCCAAATGATTATGCCAGCTCTCATTAAAGAGAA
AAATATTGTTCTTATTTATTTGCAGGGGAAATTCTGAAGAATACTATTTTCTCGGTGTTTCCCAGTTTTCTTATTTTG
Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101973785..101974021 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es