Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D069C02
Clone ID D069C02
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D069C02
Sequence
GCGGTAAGGTGCCTAATCTGCGGAGTGGCTCTTCCCTCCCCTCCCCCAGCTCGGTGGCGGCTGCCCCTCCCACCGAGGGT
GGCGCAGGGACGGTGCCATCTCGACCATGGCGGCGACTACAGCTAACCCAG
Sequence Type mRNA
Unitrap ID UNI6298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95238353..95238483 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015522 (Arnt) NM_009709 aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]


SPLK-Sequence tag 5SD069C02
Sequence
GATCCTAAGTCTCATTCCTAGTACATTGCAAACCCCACCTCCCTCCAAACACCAAAGGGTTTCTAAGCTGGATAAGGTGG
TGGCCTATATCTGTTTTTTCTTTG
Sequence Type genomic DNA
Unitrap ID UNI16021

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95244896..95244999 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015522 (Arnt) NM_009709 aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]


SPLK-Sequence tag 3SD069C02
Sequence
GGTCCTCTGGTGCTGGAGTTCCAGATTGAGCTTCCAGGTGTAGGGAACAGAGGAAGTCCTGAGTAACTGCATTGTTGACA
TGCACGTGGCCATATTGAGG
Sequence Type genomic DNA
Unitrap ID UNI16021

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95245527..95245626 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015522 (Arnt) NM_009709 aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]

 
Come back to gene ENSMUSG00000015522


For any suggestions or comments, please send an email to unitrap@crg.es