Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D171E09
Clone ID D171E09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD171E09
Sequence
ATATCCAGGTCCTGATAATGCCAGGCAGAAGGGAGTAATTATAATAGGAGATAATA
Sequence Type genomic DNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160512473..160512528 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]


SPLK-Sequence tag 3SD171E09
Sequence
GACTTGTGTATATGTGATCTTGATGAGTTTAATGAAATGTCTAATATCTTTTAAATGATTAATATGTATCCACTATTGAC
AATGAATTAGTGTTTTTGAACATTACTTTGCTCTAAGGGTTTCTCAACTTCTTTGCAGTTTATTAATTCATGTAGGAGAG
GAAACTCATTACTAGTGCTAGGTTAGTTCCACCCGAGGCTTGAAAGTGCATCATGAACACACTGCCACTGGCAGTTTCTT
TTCTCCAGCATTGATTGTAGTTTCACTGAAAGGAATTAGCCCTGACCAAAATACATTCCTGGCTGCTGGCTATGCCTACA
CCCTCCCTCGCCTGGTTATTCAGAACACTCGCACTTGATGTGCTTAGGCTTAAAAGGTCATGTTCATCTAGTTACTAATG
TTTTTGTGAGCGGGAATTTTCTTTCTGCAGGTTATTATTATGAATTGGTTTTATGTATGGAAGTTAAAAGCTGAAGGCCT
GAAATCGCAATGTTCATATTAGGATTGTTTGCTGGGTTTGGTCCTAACCAAGAAAACAAAAATAGTGGCCCACAGATGCG
GAACTTGATTTGATTGACTTCCCATACTGTAAGCCATNNNNATATTGCTGACTTGATTTGAAATAAAATAAAGTACAGTA
GGCCTTGATTNNGCTTTCAGGATGCTATC
Sequence Type genomic DNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160511407..160512075 637
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]

 
Come back to gene ENSMUSG00000040749


For any suggestions or comments, please send an email to unitrap@crg.es