Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D171C06
Clone ID D171C06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD171C06
Sequence
GATCTACTCAGCATATACTAGAGTGCATAAAAGGGCTCCTTTTATACAAAGTACTTAAAT
Sequence Type genomic DNA
Unitrap ID UNI3913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149322260..149322319 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]


SPLK-Sequence tag 3SD171C06
Sequence
AAATTAATATTCTAGGTCTAAACCACTATAATATCTTGCACTAAAAGCCAGTAAATGTATTTGTTGG
Sequence Type genomic DNA
Unitrap ID UNI3913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149322197..149322263 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es