Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D069A12
Clone ID D069A12
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D069A12
Sequence
GAAACTTTAAACAGACAGGTCTGAGAGGCCGAACTCTCCTTTTCCTTTGACTTCAGCCTCCCAGGAGTTTCACCACTTTG
GCGTGCCGGCTTCTCTTTCATTAAGTGAAAGA
Sequence Type mRNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56097213..56097324 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es