Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D170G09
Clone ID D170G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD170G09
Sequence
GCGCGCGTCCCAGCCAACCTGGGGCGGTGGTCGTCTTCTTTTCCGAGGCAGAGCGTGCCTCCTGAGGACGAGAATGCTGA
ACAGCCCTGGCTTCTGGCGCTAAGCTGCTGAACCAGGTCGCTGCTTTCTGACGGATTTTAATTTTCCTTCTCCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD170G09
Sequence
CCAGGTTGGGTCCCCCTTCCTAGTCTGTGTTCTTCTGCTGGGTCAGTTTATGGAGGCGGGGGGAGGGGGGAGATTGTTTT
CCAGGTTAGTTTTACACAAAGGAAGTGATCTTTGCACCTCTGGGGCCCCCTCCCCTTTCCCAAGCCTTACACCTTTCCAT
CTTGTTGCTAGGCTCTTAGTCCCCTTTTGGACCTTTGCCCTCTCTAGCTCGGGAATGCTCTCTGGCTGGTTGTTTCTTGC
TCATCGGGCTGCAGGCTTCCGCCTCATTCTTGCCAGCATGGGGCATGTGGTGCCAGTAAGTAGAGGACACAGCCCAGCAC
CTGAGAGAAGAGGAGGATGACAGTGGCTGGGAAAGGCGAGGCCCGGAAATCCAGGATGCTGAATGGAGCTATGATACTGG
TGAAATGTCCTAGAAAGCCCCCAAGGGACTTTTCTTAGCTGCTGCCACCGCCCTCAGCCACCCCCAACCCCAGCATCAGT
TGCCAACCATCCCAGG
Sequence Type genomic DNA
Unitrap ID UNI29976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45560808..45561303 496
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036985 (Zdhhc9) NM_172465 zinc finger, DHHC domain containing 9 Gene [Source:MGI (curated);Acc:Zdhhc9-002]

 
Come back to gene ENSMUSG00000036985


For any suggestions or comments, please send an email to unitrap@crg.es