Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D170F04
Clone ID D170F04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD170F04
Sequence
CACGCCTGCGGCTGCCCGGCCCCCGGAACGCCGCAGCTCGGGGACCCCACTCGCGGGCCTGCTTTTTCATCCCACGCCCC
CTCCGTCTCCGGAGCTCCCCTCCCCCTACTGGCCGTTAAACGTTCAGGGGTTCCCCTCCCCCCCTCAACCCCTGACTTAG
GGTTCTCTTAGGGAGAAAAAAAAACATAAGAAAGTTTTTCCTCTGCTCCCTCCCAACCCCGTTCTGCTTGAAGGGAAAGA
TTAGATAGGAGACTTTGCCT
Sequence Type genomic DNA
Unitrap ID UNI29977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93747783..93748042 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]


SPLK-Sequence tag 3SD170F04
Sequence
AGGAGCATACAGAGTTTCGGGGCTTGGCTGGAGACGGAGCCCACCATTGTAGAGCCAGCGCCGAGAGGCATTTTGCACGT
GGAGGTGCTGATACTGAAAGGGGGCGGGGTGGGCACGTGTGGGAGGGAGACGTAGGAGTGGTATCGGGGAGTCAGCCGCC
AAGGCTGCTACTTGAGGGTTCCAAGTCAGTGGGCTTCCACCATCCGTACGTTCTCCTTTGTGAAAAAGAAATCCTGACAT
TTCAGAGTCGGAAGAGACACTAGAAGTCACCCAAAGCAGCCCAGCTTCTGACGAGTGGTAGGTAGTCTGACCTCTACTTA
ACCCTACATCCATATACCACGCACTGCAGCCTAGGAAAGCACCTTC
Sequence Type genomic DNA
Unitrap ID UNI29977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93748091..93748456 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es