Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D170D06
Clone ID D170D06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD170D06
Sequence
GATATAAGCCAGCCTGGGATACAGAGCAACACTGCAAGGAAACGAAAAGGCGGAACCCAGCTTAAAGTGGTGAAGGTGAT
AGAGCAGGGAATAATGCTCAGGTGGGCTTCCTGGAAGTGGGGACTCGTTTCCTCTCCCTTACAAC
Sequence Type genomic DNA
Unitrap ID UNI4977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29853065..29853209 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024018 (1110021J02Rik) RIKEN cDNA 1110021J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915847]


SPLK-Sequence tag 3SD170D06
Sequence
CAACGNNGGCATGTTCAGCCTGGGCNNNTCGGTCCACTGGTGTTCCAGTACATCTAGGAATGTGATACAGCATGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024018


For any suggestions or comments, please send an email to unitrap@crg.es