Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D170C11
Clone ID D170C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD170C11
Sequence
CAGCCACACTAATTTATGTAGACATACAATGTTTCTGGTTTAGGCTTTTGCATATACACTA
Sequence Type genomic DNA
Unitrap ID UNI19789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74549601..74549661 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]


SPLK-Sequence tag 3SD170C11
Sequence
CTACTCTGTTTATCTGGCTTGTTCCAGCACTAGTGCTGCCATCCTTCAATTAACTTATGCCTTAATTTTCAGTCTAAGTA
ATGCATTCTCAGAGAAGCCTCCANNGAGTGTTGTTTCCAGTTTACTCTCAGCCCCAAAGTTGGATAAAAGCTACTTTAGG
CAGAACCCTCTCCTGCAAATACAACTGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033364


For any suggestions or comments, please send an email to unitrap@crg.es