Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D170A08
Clone ID D170A08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD170A08
Sequence
GATCCCCAGGATGAGGTCGGGGTCTCACCGCGCTCTGTCTGCAGGTTCACATTCCTTGCGGTATTTGGTAACCACGACCG
TGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTCATTGTTGGCTACATGAACTACATGCAGTTTATGCGCTTTGACAGT
GATGGAAC
Sequence Type genomic DNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107935..37108102 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es