Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067H04
Clone ID D067H04
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067H04
Sequence
TTTTTATTAAATATTTTTAAAATAGAGGGGAGGGGCGGCGGGGCGGTAATTCATCTGATCATTGCGTTTCTGTGGAATGT
GTTTTGAGCGCCTCTACTAATTGATGTGAGGGGACCTCACAAACTCAAAACTCCAGACATG
Sequence Type mRNA
Unitrap ID UNI10416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177362835..177362930 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es