Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D168D11
Clone ID D168D11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD168D11
Sequence
GATCAGCCAGCGCCAGCTCCGCTTCTCTTCCTGCCGCCAACGGCCCCAGGTGGAGAAGTCGCTGGCAGCGGGGCGAGCCC
CGGGGGCGCCACCACCGCCGCCGCTCCTTCAGGAGCCTTGGATGCCGCCGCTGCCGTGGCTGCCAAGATCAATGCTATGC
TCATGGCCAAAGGGAAGCTGAAACCATCTCAGAATGCGGCCGAGAAGGTATTGCGAGCGCTAGACGCTCTGCGCTTCGGG
ATTTTCTTTTTCCTCCCCTTTCTTCACCTTTCAGTTGCTTGGTCATTGGGGTTAATGAAGATGAAACCGGTTAGAGTGAA
GATCACGT
Sequence Type genomic DNA
Unitrap ID UNI29982

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88490282..88490609 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]


SPLK-Sequence tag 3SD168D11
Sequence
TCTTGTTACTTTTATGGACTAGTTTTTGTGCTTAGAAACTTAAACTCAGTTTTTTTTTATGGATATTTGAGGCAATATGT
TTTTGATCCATGAAGTTCTGGTATATCAAGTCAGTGTTTTAAAAATACTCATTTGTATGTATGTCTCTCAAGTGTCATAG
GATTTGGGGCTTGGCAATGTGA
Sequence Type genomic DNA
Unitrap ID UNI29982

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88490945..88491126 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es