Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D168B05
Clone ID D168B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD168B05
Sequence
ATGGTATCAGCCTTGTGCATCCCAGGACATTCTCTGGTCCATGACATTCTCCCTGTCTCTCTGACCT
Sequence Type genomic DNA
Unitrap ID UNI21830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35192521..35192587 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041445 (Mmrn2) NM_153127 multimerin 2 Gene [Source:MGI Symbol;Acc:MGI:2385618]

 
Come back to gene ENSMUSG00000041445


For any suggestions or comments, please send an email to unitrap@crg.es