Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D166A10
Clone ID D166A10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD166A10
Sequence
GGTTATGAGGCGTTTTCAGCAGAGCACAGGGGCGCGGAGGGGAATGAGGTACGGGGTGGAAGGGCCCTTTAAGGGTCTCT
GCGTGGCTTGGAAGCAGTATGTCTAACTGCAGTGTTGTTGTCAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGA
TGGTGTCATCGAGGTAAGGAGTGGGTGTGGACGTTAAAGGTTTGGAAAGGTACATTTTTTTTTCATGTCTTATTCATAGT
TTCATTATTAACTTACAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCG
AGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGTAAAACTC
TATTGCCGTTAGGATAAGTGCTCTGCACATACATGGACCGGAAAAGGGAAAGTGACCTTTGGGGAAGTACTAGCACCTGA
TTGTATTCCTTAAAGTGAAATGATGGCAAATCATCTTTCGGGCCTGACGAGAAATGAAGAGAATACTCTTGCTGATCACT
TATGTGGGCGTAACTTTATGTTCCAACTGGAATACAT
Sequence Type genomic DNA
Unitrap ID UNI246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23108534..23109130 589
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]


SPLK-Sequence tag 3SD166A10
Sequence
AACGATTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTAC
TGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGG
CCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTT
CACAACTGTGAAGAATTTAAAATTAAAACGTATAAATTGTCCTAGTCCTGTGAGAGCCCCCATTTTAATTGTCCATGCAT
GCAGGGAGTTTTGTTGAAAGCTAAGCAGGAAATGGGTATTGTAGGTATGACTTTAGGGATTGATTGCACCTCAACAGTTA
AACCCATAGGTTTCTCAGGGTGGATTATATCTGTACCCATTTAAAATTTGGAATGCAGTTGTGCAACATGAAAACTGCAG
TGACATGTTAAACATTTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCACTGCTATATTG
GCTTTGAAGTAATACTTCCTGATGAAGCTGCAAGCTTTATTCGGGTCAAGATTATAAGGCTCAGTGCCTTGTGGGAAAAA
ATACCAATATTT
Sequence Type genomic DNA
Unitrap ID UNI246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23109147..23109798 652
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es