Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D165H04
Clone ID D165H04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD165H04
Sequence
GATCTAATTTTATTCTGCCACATGTGGTATGCGGATTTTCCATCATCATTTGTTGAAGATGTTGTCTTCCTCCAGTGTAT
ATTTTTGGCATCTTTATCAAATATGAGATGGCTATTAATTATATGTACTCACTTTTGGGTTTTCTATTTTATTCCATGGA
CTGATATGTCTCTGTCTGAGCCACTTTCATGCTGTTTTTATTACTATAGCTCTGTGATAACTTGAAATTTGGTATAGCAA
TCACTCTGTCATCCCCATTCCCCAAGATTGTTTTGGCTATTTGGGGTCTTTTGTGATCCCATGTAAATTTTAGGATTTCT
CTTTTTCTACTTTCGAAGAGTGGTGATATCCCAGGTATGCAGTAAACTTTTATAATGTAACCCTCATGATTTTGAAGGAG
ATTTTTGTTGCTTCTATGAAATTTGTAAATAGCTTTTGGTAGGATGGCTATTTCTCTGATTTCTATGGGTATATTGAAAG
ACCCCCGCGA
Sequence Type genomic DNA
Unitrap ID UNI22936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54041226..54041699 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024976 (Shoc2) NM_019658 soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]


SPLK-Sequence tag 3SD165H04
Sequence
TGTCTTTCTTCAATTCTTTCTTTGAGACTTAATATTTTCAGTGTAGAGG
Sequence Type genomic DNA
Unitrap ID UNI22936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54041728..54041775 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024976 (Shoc2) NM_019658 soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]

 
Come back to gene ENSMUSG00000024976


For any suggestions or comments, please send an email to unitrap@crg.es