Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067F10
Clone ID D067F10
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067F10
Sequence
CCGAAGCGGTTCGCGCTGTGAGTCGGTGGCGCCGTGCAGGGCACTTAGGAACCGACAGCCTTGGCGCGGACTGGTATCCG
GTTGATTGCGGTTTGCAGGGTCCGCCATGGAGTCGGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAAAACCCTCAC
TCTGAGTACGGGCTCACAGACAGCGTTGAGAGAATAGTCGAAAATGAGAAGATTAATGCAGAAAAGTCATCGAAACAGAA
GGTGGATCTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGACTTGCTGTGC
TTGCCAAGGAAAG
Sequence Type mRNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74707060..74715753 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es